Toolbox

MultiQC Toolbox

Highlight Samples

Regex mode off

Rename Samples

Click here for bulk input.

Paste two columns of a tab-delimited table here (eg. from Excel).

First column should be the old name, second column the new name.

Regex mode off

Show / Hide Samples

Regex mode off

Explain with AI

Configure AI settings to get explanations of plots and data in this report.

Anonymize samples off

Aspect ratio

Plot scaling

Download the raw data used to create the plots in this report below:

Format:

Note that additional data was saved in multiqc_data when this report was generated.

Choose Plots

If you use plots from MultiQC in a publication or presentation, please cite:

MultiQC: Summarize analysis results for multiple tools and samples in a single report
Philip Ewels, Måns Magnusson, Sverker Lundin and Max Käller
Bioinformatics (2016)
doi: 10.1093/bioinformatics/btw354
PMID: 27312411

Settings are automatically saved. You can also save named configurations below.

Save Settings

You can save the toolbox settings for this report to the browser or as a file.

Load Settings

Choose a saved report profile from the browser or load from a file:

Tool Citations

Please remember to cite the tools that you use in your analysis.

To help with this, you can download publication details of the tools mentioned in this report:

About MultiQC

This report was generated using MultiQC, version 1.28

You can see a YouTube video describing how to use MultiQC reports here: https://youtu.be/qPbIlO_KWN0

For more information about MultiQC, including other videos and extensive documentation, please visit http://multiqc.info

You can report bugs, suggest improvements and find the source code for MultiQC on GitHub: https://github.com/MultiQC/MultiQC

MultiQC is published in Bioinformatics:

MultiQC: Summarize analysis results for multiple tools and samples in a single report
Philip Ewels, Måns Magnusson, Sverker Lundin and Max Käller
Bioinformatics (2016)
doi: 10.1093/bioinformatics/btw354
PMID: 27312411

MultiQC is developed by:

BJ-Expression v2.0.0

The report aggregates all metrics from BJ-Expression pipeline to help evaluate the performance of single-cell libraries.

session_id: a7cff8e2-8c50-44ca-9662-3d8e011fc62f
instrument: None
genome: GRCh38
read_length: 50
adapter_sequence: AAGCAGTGGTATCAACGCAGAGTACA
adapter_sequence_r2: AAGCAGTGGTATCAACGCAGAGTACAT
skip_subsampling: False
skip_10X: True
subsample_reads: 100000

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2025-11-13, 15:06 UTC

General Statistics

Showing ⁵/₅ rows and ¹⁰/₁₇ columns.

Sample Name	% Aligned	M Aligned	Library types	CFR	M Bias	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	% Duplication	% > Q30	Mb Q30 bases	Reads After Filtering	GC content	% PF
ResolveOMEv2.1-RNA-04C	74.9%	0.0M	IU	100.0%	0.5	0.0M	0.0M	63.9%	0.0M	58.3%	0.0M	2.8%	93.0%	4.6Mb	0.1M	46.2%	98.5%
ResolveOMEv2.1-RNA-04E	78.6%	0.0M	IU	100.0%	0.5	0.0M	0.0M	61.0%	0.0M	55.6%	0.0M	2.8%	92.6%	4.5Mb	0.1M	46.4%	97.9%
ResolveOMEv2.1-RNA-06B	74.0%	0.0M	IU	100.0%	0.5	0.0M	0.0M	51.3%	0.0M	46.0%	0.0M	3.3%	93.5%	4.5Mb	0.1M	47.0%	96.4%
ResolveOMEv2.1-RNA-07H	69.4%	0.0M	IU	100.0%	0.5	0.0M	0.0M	51.4%	0.0M	45.4%	0.0M	4.6%	91.9%	4.5Mb	0.1M	45.4%	98.1%
ResolveOMEv2.1-RNA-08B	74.9%	0.0M	IU	100.0%	0.5	0.0M	0.0M	61.7%	0.0M	56.2%	0.0M	2.8%	92.6%	4.5Mb	0.1M	46.0%	98.1%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	Salmon	% Aligned	% Mapped reads	`salmon-percent_mapped`
\|\|	Salmon	M Aligned	Mapped reads (millions)	`salmon-num_mapped`	read_count
\|\|	Salmon	Library types	Library types	`salmon-library_types`
\|\|	Salmon	CFR	Compatible fragment ratio	`salmon-compatible_fragment_ratio`
\|\|	Salmon	M Bias	Strand mapping bias	`salmon-strand_mapping_bias`
\|\|	STAR	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	STAR	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	STAR	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	STAR	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	STAR	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	STAR	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`fastp-pct_duplication`
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`fastp-after_filtering_q30_rate`
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`fastp-after_filtering_q30_bases`	base_count
\|\|	fastp	Reads After Filtering	Total reads after filtering (millions)	`fastp-filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`fastp-after_filtering_gc_content`
\|\|	fastp	% PF	Percent reads passing filter	`fastp-pct_surviving`

Selected Metrics

Showing ⁵/₅ rows and ²⁹/₂₉ columns.

SampleId	BJ calculated raw read pairs	Nonsubsampled reads	Subsampled reads	Pass filtered reads	Low quality reads	Many Ns reads	Prop pass-filtered reads	Prop low quality reads	Prop of many Ns read	Prop mappability	Prop exonic	Prop intronic	Prop intergenic	Prop mitochondrion	Protein-coding genes	Protein-coding transcripts	Protein-coding Mean insertsize	Protein-coding Median insertsize	Mean number of txs per gene	Coverage ratio gene-body	Median coverage gene-body	Dynamic range	Cell-type: Phase	Cell-type: Progenitor	Cell-type: Tissue	Cell-type: TGCA tissue	Cell-type: TGCA tumor
ResolveOMEv2.1-RNA-04C	716600	99484	99484	97960	1524	0	0.98468	0.01532	0.00000	0.63881	0.75140	0.21639	0.03221	0.05452	3396	5599	4525.3	749	1.36229	1.31823	0.75750	4704.37293	S	B_cell	Blood	Colon	DLBC
ResolveOMEv2.1-RNA-04E	894242	99564	99564	97494	2070	0	0.97921	0.02079	0.00000	0.60986	0.81556	0.16732	0.01711	0.05778	3999	6610	4059.9	843	1.34788	1.30155	0.77313	4356.34938	S	B_cell	Spleen	Colon	DLBC
ResolveOMEv2.1-RNA-06B	584196	100094	100094	96518	3482	94	0.96427	0.03479	0.00094	0.51298	0.75945	0.21504	0.02550	0.06891	2868	5134	4879.3	984	1.37456	1.30517	0.65702	5076.14213	G1	B_cell	Blood	Pancreas	DLBC
ResolveOMEv2.1-RNA-07H	429114	99880	99880	97966	1914	0	0.98084	0.01916	0.00000	0.51428	0.77116	0.21046	0.01838	0.09484	2316	4094	3887.4	676	1.32578	1.17727	0.76771	4804.94223	G1	B_cell	Small.Intestine	Pancreas	DLBC
ResolveOMEv2.1-RNA-08B	779982	99732	99732	97876	1856	0	0.98139	0.01861	0.00000	0.61690	0.75423	0.21686	0.02891	0.04928	3407	5643	4189.9	764	1.36173	1.27950	0.73667	4958.85208	G2M	B_cell	Small.Intestine	Pancreas	DLBC

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: SelectedMetrics-section-plot_table

Sort	Column	Description	ID
\|\|	BJ calculated raw read pairs	Number of pair of raw reads calculated with BJ downloader	`BJRawReadPairs`
\|\|	Nonsubsampled reads	Number of nonsubsampled reads	`NumNonSubsampledReads`
\|\|	Subsampled reads	Number of subsampled of eads	`RawReads`
\|\|	Pass filtered reads	Total of fastp-passing reads	`FilteredReads`
\|\|	Low quality reads	Fastp-filtered low quality reads	`LowQualityReads`
\|\|	Many Ns reads	Fastp-filtered reads with many Ns	`TooManyNReads`
\|\|	Too short reads	Fastp-filtered reads due too short	`TooShortReads`
\|\|	Prop pass-filtered reads	Proportion of fastp-passing reads with respect to subsampled reads	`PropPassingFilter`
\|\|	Prop low quality reads	Proportion of fastp-filtered low quality reads with respect to subsampled reads	`PropLowQualityReads`
\|\|	Prop of many Ns read	Proportion of fastp-filtered reads with many Ns with respect to subsampled reads	`PropTooManyNReads`
\|\|	Prop of too short reads	Proportion of fastp-filtered reads due too short with respect to subsampled reads	`PropTooShortReads`
\|\|	Prop mappability	Proportion of reads mapping to the genome	`PropMappability`
\|\|	Prop exonic	Proportion of reads mapping to exonic regions	`PropExonic`
\|\|	Prop intronic	Proportion of reads mapping to intronic regions	`PropIntronic`
\|\|	Prop intergenic	Proportion of reads mapping to intergenic regions	`PropIntergenic`
\|\|	Prop mitochondrion	Proportion of reads mapping to mitochondrion	`ProportionCountsMitochondrialGenes`
\|\|	Protein-coding genes	Number of protein-coding genes detected	`ProteinCodingGenesDetected`
\|\|	Protein-coding transcripts	Number of protein-coding transcripts detected	`ProteinCodingTranscriptsDetected`
\|\|	Protein-coding Mean insertsize	Mean insert size of protein-coding transcripts	`ProteinCodingInsertSizeMean`
\|\|	Protein-coding Median insertsize	Median insert size of protein-coding transcripts	`ProteinCodingInsertSizeMedian`
\|\|	Mean number of txs per gene	Average number of transcripts oberserved per gene	`RatioAvTxbyGene`
\|\|	Coverage ratio gene-body	Ratio of coverage if splitting the gene-body in two sections.	`RatioTranscriptBody`
\|\|	Median coverage gene-body	Median coverage across the whole gene-body	`MedianCoverageTranscriptBody`
\|\|	Dynamic range	Measures the ability to capture and describe the full spectrum of gene expression variation. The broader, indicates the more complexity of gene expression patterns detected	`DynamicRange`
\|\|	Cell-type: Phase	Seurat-based typing of cell phase	`Phase`
\|\|	Cell-type: Progenitor	Cell typing based on human cell atlas	`Progenitor`
\|\|	Cell-type: Tissue	Cell typing based on GTEX dataset	`Tissue`
\|\|	Cell-type: TGCA tissue	Cell typing based on TGCA normal cells	`TGCA_Tissue`
\|\|	Cell-type: TGCA tumor	Cell typing based on TGCA tumor cells	`TGCA_Tumor`

QualiMap stats

Showing ⁵/₅ rows and ¹⁸/₁₈ columns.

bam file	reads aligned	total alignments	secondary alignments	non-unique alignments	aligned to genes	ambiguous alignments	no feature assigned	not aligned	SSP estimation	exonic	intronic	intergenic	overlapping exon	rRNA	5' bias	3' bias	5'-3' bias	reads at junctions
ResolveOMEv2.1-RNA-04C.raw.bam	62578	72222	9644	15072	40352	2891	13907	35382	0.44/0.56	40352	12105	1802	1682	NA	0.9	100	100	8700
ResolveOMEv2.1-RNA-04E.raw.bam	59458	69556	10098	15324	41136	3393	9699	38036	0.45/0.55	41136	8799	900	1752	NA	0.9	100	100	8856
ResolveOMEv2.1-RNA-06B.raw.bam	49512	58804	9292	14424	31511	2351	10508	47006	0.46/0.54	31511	9394	1114	1665	NA	1.1	100	100	6070
ResolveOMEv2.1-RNA-07H.raw.bam	50382	64304	13922	19822	32071	2446	9961	47584	0.43/0.57	32071	9161	800	1496	NA	1.0	100	100	6093
ResolveOMEv2.1-RNA-08B.raw.bam	60380	69970	9590	14966	38749	3036	13211	37496	0.44/0.56	38749	11657	1554	1794	NA	0.9	100	100	8129

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: qualimap_stats-section-plot_table

Sort	Column	Description	ID
\|\|	reads aligned	reads aligned	`reads_aligned`
\|\|	total alignments	total alignments	`total_alignments`
\|\|	secondary alignments	secondary alignments	`secondary_alignments`
\|\|	non-unique alignments	non-unique alignments	`non_unique_alignments`
\|\|	aligned to genes	aligned to genes	`aligned_to_genes`
\|\|	ambiguous alignments	ambiguous alignments	`ambiguous_alignments`
\|\|	no feature assigned	no feature assigned	`no_feature_assigned`
\|\|	not aligned	not aligned	`not_aligned`
\|\|	SSP estimation	SSP estimation	`SSP_estimation`
\|\|	exonic	exonic	`exonic`
\|\|	intronic	intronic	`intronic`
\|\|	intergenic	intergenic	`intergenic`
\|\|	overlapping exon	overlapping exon	`overlapping_exon`
\|\|	rRNA	rRNA	`rRNA`
\|\|	5' bias	5' bias	`mqc_5_bias`
\|\|	3' bias	3' bias	`mqc_3_bias`
\|\|	5'-3' bias	5'-3' bias	`mqc_5_3_bias`
\|\|	reads at junctions	reads at junctions	`reads_at_junctions`

RNAQC composition

Heatmap

Housekeepinggenes Counts

Created with MultiQC

MT

GenesDetected

PCA

transcript body coverage

samplenames

Housekeepinggenes Cv

Created with MultiQC

HKGenes Expression

Salmon

Quantifies expression of transcripts using RNA-seq data.URL: https://combine-lab.github.io/salmonDOI: 10.1038/nmeth.4197

Created with MultiQC

STAR

Universal RNA-seq aligner.URL: https://github.com/alexdobin/STARDOI: 10.1093/bioinformatics/bts635

Summary Statistics

Summary statistics from the STAR alignment

Showing ⁵/₅ rows and ¹⁰/₁₉ columns.

Sample Name	Total reads	Aligned	Aligned	Uniq aligned	Uniq aligned	Multimapped	Avg. read len	Avg. mapped len	Splices	Annotated splices	GT/AG splices	GC/AG splices	AT/AC splices	Non-canonical splices	Mismatch rate	Del rate	Del len	Ins rate	Ins len
ResolveOMEv2.1-RNA-04C	0.0M	0.0M	63.9%	0.0M	58.3%	0.0M	100.0bp	93.0bp	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.2%	0.0%	1.4bp	0.0%	1.2bp
ResolveOMEv2.1-RNA-04E	0.0M	0.0M	61.0%	0.0M	55.6%	0.0M	100.0bp	92.7bp	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.2%	0.0%	1.3bp	0.0%	1.4bp
ResolveOMEv2.1-RNA-06B	0.0M	0.0M	51.3%	0.0M	46.0%	0.0M	99.0bp	89.1bp	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.3%	0.0%	1.3bp	0.0%	1.1bp
ResolveOMEv2.1-RNA-07H	0.0M	0.0M	51.4%	0.0M	45.4%	0.0M	100.0bp	89.5bp	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.3%	0.0%	1.4bp	0.0%	1.3bp
ResolveOMEv2.1-RNA-08B	0.0M	0.0M	61.7%	0.0M	56.2%	0.0M	100.0bp	92.8bp	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.3%	0.0%	1.5bp	0.0%	1.4bp

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: star_summary_table_table

Sort	Column	Description	ID	Scale
\|\|	Total reads	Number of input reads	`star-total_reads`	read_count
\|\|	Aligned	Mapped reads	`star-mapped`	read_count
\|\|	Aligned	% Mapped reads	`star-mapped_percent`
\|\|	Uniq aligned	Uniquely mapped reads	`star-uniquely_mapped`	read_count
\|\|	Uniq aligned	% Uniquely mapped reads	`star-uniquely_mapped_percent`
\|\|	Multimapped	Multiple mapped reads	`star-multimapped`	read_count
\|\|	Avg. read len	Average input read length	`star-avg_input_read_length`
\|\|	Avg. mapped len	Average mapped length	`star-avg_mapped_read_length`
\|\|	Splices	Number of splices: Total	`star-num_splices`	read_count
\|\|	Annotated splices	Number of splices: Annotated (sjdb)	`star-num_annotated_splices`	read_count
\|\|	GT/AG splices	Number of splices: GT/AG	`star-num_GTAG_splices`	read_count
\|\|	GC/AG splices	Number of splices: GC/AG	`star-num_GCAG_splices`	read_count
\|\|	AT/AC splices	Number of splices: AT/AC	`star-num_ATAC_splices`	read_count
\|\|	Non-canonical splices	Number of splices: Non-canonical	`star-num_noncanonical_splices`	read_count
\|\|	Mismatch rate	Mismatch rate per base	`star-mismatch_rate`
\|\|	Del rate	Deletion rate per base	`star-deletion_rate`
\|\|	Del len	Deletion average length	`star-deletion_length`
\|\|	Ins rate	Insertion rate per base	`star-insertion_rate`
\|\|	Ins len	Insertion average length	`star-insertion_length`

Alignment Scores

Created with MultiQC

fastp

All-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).URL: https://github.com/OpenGene/fastpDOI: 10.1093/bioinformatics/bty560

Fastp goes through fastq files in a folder and perform a series of quality control and filtering. Quality control and reporting are displayed both before and after filtering, allowing for a clear depiction of the consequences of the filtering process. Notably, the latter can be conducted on a variety of parameters including quality scores, length, as well as the presence of adapters, polyG, or polyX tailing.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Duplication Rates

Duplication rates of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Pipeline	Software	Version
BJ-Expression	HTSeq	`0.13.5`
	QualiMap	`2.2.2-dev`
	STAR	`2.7.6a`
	Salmon	`1.6.0`
	Samtools	`1.10`
	Seqtk	`1.3-r106`
	fastp	`0.20.1`

Toggle navigation v1.28

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

BJ-Expression v2.0.0

General Statistics

General Statistics: Columns

Selected Metrics

Selected Metrics: Columns

QualiMap stats

QualiMap stats: Columns

RNAQC composition

Heatmap

Housekeepinggenes Counts

MT

GenesDetected

PCA

transcript body coverage

samplenames

Housekeepinggenes Cv

HKGenes Expression

Salmon

STAR

Summary Statistics

STAR: Summary Statistics: Columns

Alignment Scores

fastp

Filtered Reads

Duplication Rates

Insert Sizes

Sequence Quality

GC Content

N content

Software Versions

v1.28

Highlight Samples

Rename Samples

Show / Hide Samples